Читать книгу Bioinformatics - Группа авторов - Страница 15

As described above, the major sources of nucleotide sequence data are the databases involved in INSDC – DDBJ, ENA, and GenBank – with new or updated data being shared between these three entities once every 24 hours. This transfer is facilitated by the use of common data formats for the kinds of information described in detail below.

The elementary format underlying the information held in sequence databases is a text file called the flatfile. The correspondence between individual flatfile formats greatly facilitates the daily exchange of data between each of these databases. In most cases, fields can be mapped on a one-to-one basis from one flatfile format to the other. Over time, various file formats have been adopted and have found continued widespread use; others have fallen to the wayside for a variety of reasons. The success of a given format depends on its usefulness in a variety of contexts, as well as its power in effectively containing and representing the types of biological data that need to be archived and communicated to scientists.

In its simplest form, a sequence record can be represented as a string of nucleotides with some basic tag or identifier. The most widely used of these simple formats is FASTA, originally introduced as part of the FASTA software suite developed by Lipman and Pearson (1985) that is described in detail in Chapter 3. This inherently simple format provides an easy way of handling primary data for both humans and computers, taking the following form.

>U54469.1 CGGTTGCTTGGGTTTTATAACATCAGTCAGTGACAGGCATTTCCAGAGTTGCCCTGTTCAACAATCGATA GCTGCCTTTGGCCACCAAAATCCCAAACTTAATTAAAGAATTAAATAATTCGAATAATAATTAAGCCCAG TAACCTACGCAGCTTGAGTGCGTAACCGATATCTAGTATACATTTCGATACATCGAAATCATGGTAGTGT TGGAGACGGAGAAGGTAAGACGATGATAGACGGCGAGCCGCATGGGTTCGATTTGCGCTGAGCCGTGGCA GGGAACAACAAAAACAGGGTTGTTGCACAAGAGGGGAGGCGATAGTCGAGCGGAAAAGAGTGCAGTTGGC

For brevity, only the first few lines of the sequence are shown. In the simplest incarnation of the FASTA format, the “greater than” character (>) designates the beginning of a new sequence record; this line is referred to as the definition line (commonly called the “def line”). A unique identifier – in this case, the accession.version number (U54469.1) – is followed by the nucleotide sequence, in either uppercase or lowercase letters, usually with 60 characters per line. The accession number is the number that is always associated with this sequence (and should be cited in publications), while the version number suffix allows users to easily determine whether they are looking at the most up-to-date record for a particular sequence. The version number suffix is incremented by one each time the sequence is updated.

Additional information can be included on the definition line to make this simple format a bit more informative, as follows.

>ENA|U54469|U54469.1 Drosophila melanogaster eukaryotic initiation factor 4E (eIF4E) gene, complete cds, alternatively spliced.

This modified FASTA definition line now has information on the source database (ENA), its accession.version number (U54469.1), and a short description of what biological entity is represented by the sequence.