Читать книгу Cell Biology - Stephen R. Bolsover - Страница 85

1 3.1 Theme: Mutationsframeshiftmissensenonsensenone of the aboveConsider the mRNA strand 5′ ACU AUC UGU AUU AUG UUA CAC CCA 3′ coding for the amino acid sequence TICIMLHP. For each of the errors described below, choose the appropriate description from the list above. Refer to Figure 3.9 on page 44 while answering this question.a change of a U to a A in the 6th codon of the sequence, generating the sequence5′ ACUAUCUGUAUUAUGUAACACCCA 3′a change of a U to a C in the 6th codon of the sequence, generating the sequence5′ ACUAUCUGUAUUAUGCUACACCCA 3′a change of a U to a G in the 2nd codon of the sequence, generating the sequence5′ ACUAGCUGUAUUAUGUUACACCCA 3′deletion of a U in the 3rd codon, generating the sequence 5′ ACUAUCUGAUUAUGUUACACCCA 3′deletion of an A in the 4th codon, generating the sequence5′ ACUAUCUGUUUAUGUUACACCCA 3′

2 3.2 Theme: Bases and amino acidsadeninealaninearginineaspartatecytosineglutamateglycineguaninethymineuracilalineFrom the above list of compounds, select the one described by each of the descriptions or questions below.the base that is found in RNA but not in DNAa positively charged amino acid that is found in large amounts in chromatin, where it neutralizes the negative charge on the phosphodiester bonds of DNAa protein is described as having the mutation G5E. Which amino acid is present in this protein in place of the amino acid present in the normal protein?the base that pairs with guanine in double‐stranded DNAthe base that pairs with thymine in double‐stranded DNA

3 3.3 Theme: Structures associated with DNA30 nm solenoidcodoneuchromatingeneheterochromatinnucleoidnucleosomeFrom the above list of structures, select the one described by each of the descriptions below.a highly compacted, darkly staining substance comprising DNA and protein found at the nuclear peripherya mass of DNA and associated proteins lying free in the cytoplasma structure formed when a 146 base‐pair length of DNA winds around a complex of histone proteinsthe form adopted by those parts of chromosomes that are being transcribed into RNA